dentek
dentek

1 Тейксейра К. К. , 1 Немелівські Є. , 2 Каркія К. ; 2 Леґерос Р. З.
1Відділення фундаментальних наук і біології черепно-лицевої ділянки,
Стоматологічний коледж при Університеті Нью-Йорку, Нью-Йорк;
2Відділення біоматеріалів і біоміметики, Стоматологічний коледж
при Університеті Нью-Йорку, Нью-Йорк
C. C. Teixeira, Y. Nemelivsky, C. Karkia, B. Z. Legeros

Двофазний кальцій сульфат: каркас для дозрівання хондроцитів епіфізарної пластини*

(З використанням матеріалу 4BONES, MBCP (macroporous biphasic calcium phosphate) продукт компанії «MIS»)

*Дані опубліковані в «TISSUE ENGINEERING». Volume 12. Number 8. 2006.

Вступ

Уже багато років кісткову пластику застосовують для репарації дефектів, спричинених травмою чи патологією. Блоки автокістки (власної кістки пацієнта) вважають «золотим стандартом» завдяки їхньому остеогенному потенціалу і відсутності відторгнення. Однак, автоблоки мають ряд недоліків, зокрема, непередбачуваний ступінь резорбції і зміни контуру, можливі ускладнення зі сторони донорської ділянки, збільшення затрат часу та коштів на операцію. Блоки аллокістки (забраної у того ж виду) і блоки ксенокістки (забрані в іншого виду, наприклад, бичача кістка чи корал) також мають остеогенний потенціал, але і ряд значних недоліків, таких як відмінності у властивостях і якості кістки, ризик передачі захворювання, вплив на екологію (знищення коралових рифів) [1,2]. Покращення якості біоматеріалів медичного призначення сприяло розвитку синтетичних кісткових блоків або аллопластів.
Ці матеріали включають неорганічні (такі як алюміна, цирконій, фосфати кальцію, сульфати кальцію, карбонат кальцію, біоактивні скла) [3, 4] і органічні або полімерні матеріали (такі як колаген, хітин, агароза, гідроксиефіри і полілактид/полігліколева кислота) [5, 6]. Для індукції остеогенезу на цих каркасах фактори росту в поєднанні з деякими біоматеріалами чи клітинами-попередниками. На даному етапі були спроби досягти репарації чи регенерації лише за рахунок ендесмального формування кістки, при тому, що в природі існує два механізми скелетного розвитку: ендесмальний і енхондральний. Ендесмальне формування кістки передбачає диференціацію мезенхімальної клітини безпосередньо в остеобласт, у той час як енхондральне окостеніння передбачає поступове заміщення хряща кісткою. Довгі кістки, кістки таза, хребет, основа черепа і нижня щелепа формуються внаслідок енхондрального типу [7]. Метою даного дослідження є відтворення природного процесу енхондрального формування кістки за допомогою створення in vitro хрящової пластини, яка б після імплантації in vivo ремоделювала в кістку. Цей альтернативний метод вирощування кістки за допомогою тканинної інженерії має суттєві переваги, зокрема хондроцити є стійкими до низького рівня кисню, і ці клітини здатні індукувати васкуляризацію і остеогенез.
Ми сподіваємось, що кістку, вирощену таким способом, неможливо буде відрізнити від природної: вона матиме такі ж властивості, аналогічно відповідатиме на навантаження і, що найголовніше, матиме потенціал до росту як власна кістка пацієнта. Нами розроблено метод вирощування епіфізарної пластинки на каркасі з кальцію фосфату, а також метод індукції дозрівання хондроцитів і відкладення ними екстрацелюлярного матриксу.

Матеріали та методи дослідження

Характеристики каркасу

Використовували макропористий двофазний кальцій фосфат (MBCP®, «Biomatlante», Франція), що на 60 % складається з гідроксиапатиту і на 40 % з β-трикальцій фосфату. Доведено, що пористий двофазний кальцій сульфат може бути відповідним каркасом для заміни кістки [4, 11,12]. Загальна пористість MBCP становить 70 %, з розміром пор аналогічним трабекулярній кістці.

Культура хондроцитів

Забір хондроцитів здійснювали з великогомілкової кістки 18-денного курячого ембріону, за методом Rajpurohit та співавт. [8], і вирощували впродовж 1 тижня. За цей період фібробласти й остеобласти (якщо вони були присутні) прикріплялись до чашки Петрі. Культури, в яких було виявлено проростання фібробластів/остеобластів, до експерименту не допускали. Окремо виділені культури хондроцитів (0,125 мільйонів клітин) поміщали в чашки Петрі з частинками MBCP. При цьому уникали посіву клітин безпосередньо на каркас. У цих клітин був чітко визначений хондроцитарний фенотип. Хондроцити вирощували безперервно, без подальшого субкультивування, впродовж 3 тижнів при температурі 7° С і при наявності 5 % діоксиду вуглецю. Культури щоденно підживлювали модифікованим за Дульбекко середовищем Іґла, що містило 10 % Nu-сироватку («Fisher Scientific», Fairlawn, NJ), 2mM L-глютаміну, 50 мкг/мл аскорбінової кислоти («Sigma», St.Louis, MO) і 100 од./мл пеніциліну-стрептоміцину («Cellgro», Herndon, VA). Після першого тижня хондроцити з частинками MBCP перенесли в нові чашки Петрі й щоденно додавали 100 nM трансретинолової кислоти (третиноїн) у 95 % етанолі, щоб індукувати дозрівання хондроцитів і синтез матриксу. Контрольним культурам додавали лише розчинник (95 % етанолу). У кінці кожного тижня здійснювали забір частинок для аналізу.


Солюбілізація і білковий аналіз

Проводили забір хондроцитів/часточок і екстракцію клітин за допомогою 0,1 % Тriton X-100 («Fisher Scientific», Fairlawn, NJ). Екстракт 6 разів змішали у вортекс-міксері від 10 до 20 с і відцентрифугували при 2000 об./хв. Вимірювали активність лужної фосфатази і вміст протеїнів у супернатанті. Підрахунок протеїнів проводили за допомогою DC ProteinAssay («BioRadLaboratories», Hercules, CA) в електофотометрі відповідно до інструкцій виробника.

Активність лужної фосфатази (ЛФ)

Активність ЛФ вимірювали за методом, описаним Leboy і співавт. [15], який базується на гідролізі нітрофенілфосфату.


Мікроскопічний аналіз

Частинки/хондроцити промивали натрій-фосфатним буфером, фіксували у закріплювачі Камовського 4 % параформальдегіді та 5 % глютаральдегіді й зневоднювали в етанолі. Після цього зразки занурювали в глікольметакрилат і робили шліфи товщиною 2 мкм, які забарвлювали тулоїдиновим синім і досліджували під оптичним мікроскопом (Nikon E 600)

Аналіз скануючої електронної мікроскопії (СЕМ)

Досліджуваний матеріал промивали натрій-фосфатним буфером і фіксували в 2 % глютаральдегіді. Пізніше частинки зневоднювали при кімнатній температурі за рахунок занурювання в градуйовані розчини етанолу. Далі частинки розміщували на алюмінієвих пластинах з графітовим покриттям і напилювали золото-паладієвий сплав, після чого аналізували за допомогою СЕМ («Jeol JSM 5400», Японія).

Забарвлення лужної фосфатази

Для забарвлення лужної фосфатази використали розчин нафтол As-Bi фосфату. Застосували спосіб, описаний Iwamoto і співавт. [16]. Частинки хондроцитів/MBCP промивали натрій-фосфатним буфером, поміщали в цьому розчині в інкубатор на 15 хвилин при температурі 37° С, повторно промивали натрій-фосфатним буфером і фіксували в 3,7 % розчині парафор-мальдегіду в натрій-фосфатному буфері.

Забарвлення альціановим синім

Частинки ходроцитів/MBCP двічі промивали натрій-фосфатним буфером, після чого забарвлювали в розчині 1 % альціанового синього («Sigma», St.Louis, MO) у 3 % оцтовій кислоті протягом 45 хвилин при кімнатній температурі. Після цього частинки 2 хвилини промивали 3 % оцтовою кислотою, далі — натрійфосфатним буфером і фіксували у 37 % розчині параформальдегіду у натрій-фосфатному буфері.

Виділення мРНК і полімеразна ланцюгова реакція зі зворотньою транскрипцією

Щоб охарактеризувати профіль експресії генів хондроцитів, вирощених на частинках MBCP, на ізольованій з 3-тижневої культури клітин мРНК було проведено напівкількісну полімеразну ланцюгову реакцію у реальному часі зі зворотною транскрипцією (real time RT-PCR). мРНК була ізольована за допомогою набору RNeasy mini kit («Qiagen Inc.», CА) згідно з рекомендаціями виробника. ПЛР-ЗТ була проведена з використанням праймерів, специфічних до курячих генів. Колаген І типу: вперед: GCCGTGACCTCAGACTTAGC; у зворотному напрямі: TTTTGTCCTTGGGGTTCTTG; колаген ІІ типу: вперед: GACCTCGTGGTGACAAAGGT; у зворотному напрямі: CATGCCGTTAGAGCCATCTT; колаген Х типу: вперед: AGTGCTGTCATTGATCTCATTGGA; у зворотному напрямі: TCAGAGGAATAGAGACCATTGGATT; лужна фосфатаза: вперед: CCTGACATCGAGGTGATCCT; у зворотному напрямі: GAGACCCAGCAGGAAGTCCA; cbfа1: вперед: CTTAGGAGAAGTGCCCGATG; у зворотному напрямі: CCATCCACCGTCACCTTTAT. Кислий рибосомальний протеїн мРНК використовували як початок для підрахунку (вперед: AACATGTTGAACATCTCCCC; у зворотному напрямі: ATCTGCAGACAGACGCTGGC). Усі праймери було придбано в «Qiagen Inc.». Для проведення ПЛР-ЗТ у реальному часі використали набір QuantiTect SYBR Green RTPCR kit («Qiagen Inc.») і систему DNA Engine Optican 2 («Roche Molecular Systems», Pleasanton, CA) Рівні транскриптів були представлені як число зміни кількісних показників (fold change) в експресії генів і підраховували за допомогою порогового циклу (Ct) і формули, наведеної нижче, де: ctl — це хондроцити, вирощені без додавання ретинолової кислоти (РК); exp — хондроцити, на які 2 тижні діяли РК; а rib – це кислий рибосомальний протеїн: X = 2ΔΔCt, де ΔΔCt = ΔЕ-ΔС, а ΔЕ =Сtexp– Ctrib і ΔС=Сtctl-Ctrib. Негативні значення ΔΔCt трактували як збільшення, а позитивні — як зменшення експресії генів.

Статистичний аналіз

Весь експеримент повторили 3–4 рази і визначили середні показники та стандартні похибки. Статистично значимі відмінності між тест-групами й контрольними групами визначали за тестом ANOVA. Р-показник відповідає порівнянню параметрів, отриманих в експериментальній групі і відповідній групі контролю. Статистична значимість була встановлена на рівні p<0.05
Мал. 1. Ріст хондроцитів на MBCP. Фотографії, отримані за допомогою скануючого електронного мікроскопа, демонструють хондроцити наприкінці першого (А), другого (Б) і третього тижнів (В). У кінці кожного тижня здійснювали забір частинки каркасу, проводили їх фіксацію, дегідратацію, напилювали шар золота й аналізували в СЕМ
Мал. 2. РК змінює активність лужної фосфатази і синтез протеогліканів. Хондроцити, взяті з великогомілкової кістки, вирощували впродовж 1 тижня на частинках MBCP: а) впродовж наступних 2 тижнів до поживного середовища щодня додавали РК; б) у групі контролю (а) досередовища додавали розчинник. Знімки частинок хондроцитів/MBCP отримали після забарвлення в червоний (для візуалізації активності ЛФ) і синій (виявлення рівня протеогліканів) колір. Початкова щільність шару клітин була одинакова для експериментальної і контрольної груп. Кольорові фото можна переглянути онлайн на www.lieberpub.com

Результати

Прикріплення і проліферація хондроцитів

СЕМ підтвердила, що хондроцити прикріплюються і проліферують на каркасі з МBCP (мал. 1). Наприкінці 1 тижня хондроцити сформували практично суцільний шар на поверхні каркасу. Впродовж наступних 2 тижнів шар став ще щільнішим. У кінці 3 тижня можна було спостерігати суцільний шар полігональних хондроцитів, що вкривав повністю каркас і його пори. (мал. 1в).


Дозрівання хондроцитів

Застосування ретинолової кислоти спричинило помітне збільшення активності лужної фосфатази, що підтверджується глибоким червоним забарвленням (мал. 2б, частинки ліворуч). Збільшення кількості протеоглікану в екстрацелюлярному матриксі підтверджує інтенсивне синє забарвлення (мал. 2б, частинки праворуч). Рівні активності лужної фосфатази також були виміряні спектрофотометрично. При наявності ретинолової кислоти спостерігали значне збільшення ферментативної активності лужної фосфатази, що безпосередньо залежало від тривалості дії РК (мал. 3). Через 3 тижні відмінності між хондроцитами, на які діяли і не діяли РК, були очевидними. При відсутності РК клітини прикріплювались і проліферували на частинках MBCP®, повністю покриваючи за 3 тижні поверхню каркасу та його пори (мал. 4а). Аналіз СЕМ підтвердив наявність безперервного шару плоских, полігональних хондроцитів на поверхні MBCP® (мал. 5а). Додавання РК у живильне середовище культур спричиняло відкладення помітно товстішого екстрацелюлярного матриксу на поверхні частинок (мал. 4б). Зміни, спричинені додаванням РК, також були помітні на СЕМ. Малюнок 5б підтверджує, що зрілий екстрацелюлярний матрикс повністю покриває поверхні часточок і навіть частково закриває пори (стрілки на мал. 5б). Хондроцити оточені великою кількістю волокон, що утворюють складну сітку (мал.5в). Щоб охарактеризувати профіль експресії генів хондроцитів, вирощених на частинках MBCP®, на ізольованій з 3-тижневої культури клітини мРНК було проведено ПЛР-ЗТ. Додавання РК в експериментальній групі значно збільшувало тран- скрипцію колагену І типу і лужної фосфатази порівняно з групою контролю. При цьому збільшення транскрипції сbf1 було не таким великим (мал. 6). Водночас, рівні мРНК колагену ІІ типу і Х типу зменшувались при додаванні РК (мал. 6)
Мал. 3. РК збільшила ферментативну активність ЛФ. Хондроцити, взяті з великогомілкової кістки, вирощували впродовж 1 тижня на частинках MBCP.
Упродовж наступних 2 тижнів до поживного середовища додавали або не додавали РК (100 nM).
У кінці кожного тижня клітини збирали для аналізу та вимірювали активність ЛФ за допомогою спектрофотометрії. Результати отримані з 3 експериментів. Статистично значима різниця була встановлена на рівні p<0,05
Мал. 4. Хондроцити вирощені на каркасі з MBCP. Хондроцити вирощували впродовж 1 тижня на частинках MBCP. Упродовж наступних 2 тижнів до поживного середовища додавали або не додавали РК (100 nM). У кінці 3 тижня зразки фіксували в глютаральдегіді, зневоднювали в етанолі та занурювали в метилметакрилат. Шліфи забарвлювали толуїдиновим синім, досліджували в мікроскопі й фотографували.
За відсутності РК (а) хондроцити сформували тонкий безперервний шар клітин (вказаний стрілкою на а). Коли до культур додавали РК (б), екстрацелюлярний шар ставав помітно товстішим і можна було спостерігати гіпертрофовані хондроцити (вказані стрілкою на б)

Обговорення

Спроби створити каркас для in vitro хряща проводили з метою подальшого використання в замісній терапії суглобових хрящів [17]. У нашому дослідженні ми пропонуємо створити in vitro каркас кальцифікованого хряща як матеріалу з потенціалом росту, для заміни кістки. Частинки MBCP® і раніше використовували як каркас для формування кістки, але клітинами-попередниками у тих випадках виступали остеобласти [11, 18]. В той час як матеріали з кальцій фосфату, такі як гідроксиапатит чи β-трикальцій фосфат, характеризують в основному як остеокондуктивні, але не остеоіндуктивні [19,20], наявні дані [4, 21, 22], що деякі пористі гідроксиапатити мають остеоіндуктивні властивості завдяки своїй пористості, яка уможливлює прикріплення ендогенних кісткових морфогенетичних протеїнів (ВМР). До того ж, макропористість MBCP® знаходиться в межах оптимальних розмірів (200—400 мкм) для носіїв ВМР, щоб останні могли розпочати пряме формування кістки [21, 22]. Крім того, склад MBCP і краща розчинність β-трикальцій фосфату, ніж гідроксиапатиту, може також сприяти остеогенезу [23, 24]. Ми обрали MBCP® як каркас для енхондрального формування кістки, керуючись даними цих та інших досліджень, які підтверджують, що такі матеріали сприяють проростанню остеобластів [11, 18] і остеокластичній резорбції [25].

Мал. 5. СЕМ дозріваючих на MBCP хондроцитів. Хондроцити вирощували впродовж 1 тижня, наступні 2 тижні до поживного середовища додавали або не додавали РК. У кінці 3 тижня зразки фіксували, зневоднювали, напиляли шар золота, аналізували в СЕМ і фотографували. За відсутності РК (а) хондроцити формували тонкий шар клітин, полігональної форми. Клітини, що вирощувались з додаванням 100 nM РК (б, в), продукували матрикс, багатий на волокна (стрілки на в), що іноді навіть закривав пори в каркасі (стрілки на б)
Наше дослідження показало, що хондроцити можуть прикріплюватись і проліферувати на частинках MBCP. Щоб визначити, чи хондроцити, вирощені на поверхні мінерала, здатні дозрівати, ми діяли на клітини РК. Додавання РК спричинило збільшення експресії гена ЛФ і її ферментативної активності, що, згідно з іншими дослідженнями [16], є важливим маркером дозрівання. До того ж, ми спостерігали збільшення кількості сbf1, що є позитивним регулятором диференціації як остеобластів, так і хондроцитів [26, 27]. Відзначимо також те, що додавання РК зменшувало експресію колагену ІІ і Х типів і збільшувало експремію колагену І типу. Раніше вже доповідали про те, що експресія генів хондроцитів епіфізарної пластини характеризується остеобластним фенотипом [28]. Дані досліджень in vivo і in vitro підтверджують, що гіпертрофовані хондроцити можуть диференціюватись і далі, та виділяти маркери кісткових клітин [29, 30], відзначаючи роль хондроцитів у початкових стадіях формування кістки. З відомих нам даних, ми перші доповідаємо про хондроцити, вирощені на каркасі MBCP. Раніше у дослідженнях доповідали, що хондроцити суглобового хряща можуть прикріплюватись і проліферувати на колагеновій губці з додаванням кристалів кальцій фосфату для підвищення стабільності [31], однак тоді не зазначали фенотип хондроцитів. Інше дослідження підтвердило, що хондроцити, взяті з гребеня клубової кістки кроля, вирощені на блоках гідроксиапати-ту, й імплантовані в кісткові дефекти, сприяли значному збільшенню відкладення кісткової тканини, ніж коли підсаджувались блоки самого лише гідроксиапатиту [32]. На відміну від хондроцитів суглобового хряща, наші хондроцити були забрані з епіфізарної пластини і мають потенціал до гіпертрофії і кінцевої диференціації, можуть модифікувати каркас і створювати таким чином покращений остеоіндуктивний матеріал. Навіть більше, гіпертрофовані клітини здатні продукувати судинний ендотеліальний фактор росту (VEGF), який запускає механізм реваскуляризації, необхідний для енхондрального формування кістки [9, 10]. І дійсно, коли хондроцити суглобового хряща змішані з остеобластами склепіння черепа, поміщені в альгінат, були імплантовані імунодефіцитній миші, в останньої спостерігалось енхондральне формування кістки. Одночасно трансплантовані клітини розвинулись кожна у свій тип тканин (хрящ, кістково-хрящове з’єднання, кістку) та почали стимулювати розвиток кістки [33]. У той час як всі ці експерименти припускали, що клітини виділяють фактори росту/диференціації, які впливають на просторову будову й активність одна одної, Gerstenfeld і співавт. підтвердив, що гіпертрофовані хондроцити виділяють розчинні елементи, які селективно сприяють остеогенезу [34]. Якщо метою теперішніх досліджень є виявлення цих факторів і встановлення механізмів їх дії, наш підхід — представлення джерела факторів диференціації, має великий потенціал. Наше основне завдання — створити проміжний каркас для енхондрального формування кістки з потенціалом росту.
Мал. 6. Профіль експресії генів дозріваючих хондроцитів. Хондроцити вирощували впродовж 1 тижня, наступні 2 тижні до поживного середовища додавали або не додавали РК. У кінці 3 тижня з клітин виокремлювали мРНК. Проводили напівкількісну ПЛР-ЗТ в реальному часі з застосуванням праймерів специфічних до генів сbf1, ЛФ, колагену І, ІІ і Х типів. Рівень експресії генів було представлено як число зміни кількісних показників (fold change) між рівнями мРНК хондроцитів, вирощених з додаванням РК, і хондроцитів, вирощених без додавання РК (група контролю). Результати було отримано з 4 експериментів. Статистично значима відмінність експериментальної та контрольної груп була встановлена на рівні p<0,05
Висновок: ми розробили метод вирощування і стимуляції дозрівання хондроцитів на мінеральному шаблоні, MBCP. Подальші дослідження будуть присвячені встановленню придатності даного каркасу проміжної ланки для енхондрального формування кістки.
 

Подяка

Дослідження проводилось за підтримки Фонду досліджень кальціюфосфату, професора L. Linkow у курсі стоматологічної імплантації; Відділення біоматеріалів, біоміметики, фундаментальної науки і біології черепно-лицевої ділянки, стоматологічного коледжу Університету Нью-Йорка. Автори хочуть подякувати Dr.R. Rohanizadeh за професійну співпрацю.

Література

Література
1. Aichelmann-Reidy M.E. and Yukna R.A.Bone replacement grafts. The bone substitutes. — Dent. Clin. North Am. 42, 491,1998.
2. Rosenberg E. Amd Rose L.F. Biologic and clinic comsiderations for autografts and allografts in periodontal regeneration theraphy. — Dent.Clin. North Am. 42, 467, 1998.
3. Hulbert S.F., Morrisom S.J., and Klawitter J.J. Tissue reaction to three ceramics of porous and non-porous structures. — J. Biomed.Mater.Res., 6, 347, 1972.
4. LeGeros R.Z, Parsons J.R., Daculsi G., Driessens F., Lee D., Liu S.T., Metsger S., Peterson D. And Walker M. Significatiance of the porosity and physical chemistry of calcium phosphate ceramics. Biodegradationbioresorption.— Ann. NY Acad. Sci. 523, 268, 1988.
5. Burg K.J., Porter S. and Kellam J.F. Biomaterials developments for bone tissue engineering. -Biomaterials 21, 2347, 2000.
6. Lahij A., Sohrabi A. Hungerford D.S. and Frondoza C.G. Chitosan supports the expression of expression of extracellular matrix proteins in human osteoblasts and chondrocytes. — J. Biomed. Mater. Res. 51, 586, 2000.
7. Howell S.D., Dean D. The biology, chemistry andbiochemistry of the mammalian growth plate. — In:
Coe F.L., Favus M.J. eds. Disorders of Bone and Mineral Metabolism. — New York: Raven Press, 1992, pp.313-353.
8. Rajpurohit R., Koch C.J., Tao Z., Teixeira C.M. And Chapiro I.M. Adaptation of chondrosytes to low oxygen tencion: relationship between hypoxia and cellular metabolism. — J. Cell. Physiol. 168, 424, 1996.
9. Maes C., Carmeliet P., Moermans K., Stockmans I.,Smets N., Collen D., Bouilon R., Carmeliet G. Impaired angiogenesis and endochondral bone formation in mice lacking the vascular endothelial growth factor isoforms VEGF-164 and VEGF-188. — Mech. Dev. 111, 61, 2002.
10. Petersen W., Tsokos M., Pufe T. Expressin of VEGF-121 and VEGF-165 in hypertrophic chondrocytes of the human growth plate and epiphyseal cartilage.— J. Anat. 201, 153, 2002.
11. Daculci G., Passuti N., Martin S., Deudon C. Legeros R.Z., Raher S. Macroporous calcium phosphate ceramic for long bone surgery in humans and dogs. — Clinical and histological study. — J. Diomed. Mater. Res. 24, 379, 1990.
12. Nery E.B., LeGeros R.Z., Lynch K.L., Lee K. Tissue response to piphasic calcium phosphate ceramic with different ratios of HA/ beta TCP in periodontal osseous defects. — J. Periodont. 63, 729, 1992.
13. Leboy P.S., Shapiro I.M., Uschmann B.D., Oshima O., Lin D. Gene expressin on mineralizing chick epiphyseal cartilage. — J. Biol.Chem., 263 8515, 1988.
14. Kirsch T., Nah H.D., Shapiro I.M., Pacifici M.Regulated production of mineralization-competent matrix vesicles in hypertrophyc chondrocytes. — J.Cell. Biol. 137, 1149, 1997.
15. Leboy P.S., Vaias L., Uschmann B., Colub E., Adams S.L., Pasifici M. Ascorbic acid induces alkaline phosphatise, tape X collagen and calcium depositin in cultured chick chondrocytes. —J.Biol. Chem. 264, 17281, 1989.
16. Iwama to M., Yagami K., Shapiro I.M., Leboy P.S., Adams S.L., Pacifici M. Retinoic acid is a major regulator of chondrocyte maturation and matrix mineralization. — Micros. Res. Tech. 28, 483, 1994.
17. Hutmacher D.W. Scaffolds in tissue engineering bone and cartilage. — Biomaterials, 21, 2529, 2000.
18. Gauthier O., Bouler J.M., Aguado E., Pilet P., Daculsi G. Macroporous biphasic calcium phosphate ceramics: influence of macropore diameter and macroporosity percentageon bone ingrowth. -Biomaterials 19, 133, 1998.
19. Wolford L.M., Wardrop R.W., Hartog J.M. Coralline porous hydroxylapatite as a bone graft substitute in orthognatic surgary. — J. Oral Maxillofac. Surg. 45, 1034, 1987.
20. LeGeros R.Z. Properties of osteoconductive biomaterials: calcium phosphates. — Clin. Orthop. 81, 2002.
21. Reddi A.H. Morphogenesis and tissue engineering of bone and cartilage: inductive signals, stem cells and biomimetic biomaterials. — Tissue Eng., 6, 351, 2000.
спитати консультанта
заповніть всі обов'язкові поля форми (*)
Ваше і'мя *
Ваша ел. адреса *
повідомлення *
надрукуйте контрольне число *
спеціальні пропозиції

Акція на імплантати з конічним з'єднанням

За більш детальною інформацією звертайтесь за телефонами 044-498-28-51 або 093-930-44-55. Завжди раді Вашим дзвінкам!

перейти к опису

ПРОДОВЖЕНА спеціальна акція на імплантати з конічним з'єднанням С1

З нагоди 20-річчя компанії Medical Implants System та 13-річчя її представника в СНД

перейти к опису

Розширений хірургічний набір для встановлення імплантатів лише за 268 $

При купівлі 30 імплантатів MIS - розширений хірургічний набір лише за 268$

перейти к опису

Акція з нагоди 20-річчя компанії MIS

Знайомтесь з умовами акції тут

перейти к опису

© 2010 - 2017 Все права належать компаниії Дентек